Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0050
Clone ID XP0050
Vector pGT0lxf
Project sanger

Sequence tag XP0050
Sequence
TTACAAGAGTATAGATACGAAGTCAAGACTTCAAGAGAGCATGCAAGTCCTTCTTGGTAAAGTGACGGAAGAATGCCGCA
AACTCTCAGGACTGCAGACGCGCTTAGGCAAGATCCATGAACAACAGACAGATGGCTGTGGCACTAGAGTTTGCTGAACA
AAATGCGGCAGAAGAGGAAGCAGGTCTTCTGTCAGGTTGTTCTCAGAGTGCTTTACAGAGCACAGATGTCAGTCTTGAGA
GCAAGGTGTCTTCTCTGCCTGCGAGTGAGAAAAGCAGAGAATGTGAGAGGCAAGTCCAAGAGTTACAGAGCCCTGTGGCT
GCCGGACAGCTGCAGCTCACGGAAACCGAAGCAAACCACAGAGCAGAAATTGAGTCTTTGCAGCAGAGACTTGAGGCTGT
CAGTGAGGCTCCGGTTCAGCCAAGCTTGTCCATTGATTCTGTGGTGTTTAAAGGATCTGGTGCCCAGAAACCAGTGTACT
GTGGAAGCTGTCTAAGAGCAGTGTGTGGATGGCACAGCAAAG
Sequence Type mRNA
Unitrap ID UNI2216

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3972010..3981214 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es