Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12836A10
Clone ID IST12836A10
Vector VICTR76
Project tigm

Sequence tag IST12836A10BBF1
Sequence
GCTTCACGCACTTATCAAGTTAGAACCTCAAAACATTTATCAAATTAGAACCTCAAAAACCTGGGGGGGGGTTGTTTGTT
TGTTNACACANNTTNANCAGTGCACCATTATAAACTCCNNTTACNCTTTNNCATTCCTGGTTNGGGGAANCCAATCCCNA
NAAANACNANCTNTTANNCNGCCCAAGGTCNNCCAAANANTTCNNAAGGTNNNTAACGGANACCACCTCTNNGGACCCCG
CAAACCCTANGCTANNANCCCGGACTAANANAGCCCCGGGAGGTGCTTTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12836A10HMF1
Sequence
CCATCTCTGCCTCCCGAGTGCTGAGATTAAAGGCGTGCACCACCACACCCGGCTATT
Sequence Type genomic DNA
Unitrap ID UNI31127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23714823..23714875 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157463687..157463739 51
NO GENE  

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es