Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_170A4-3
Clone ID CMHD-GT_170A4-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_170A4-3
Sequence
CCACAACCTGGTGATGAAGCACCTCCCTGGGGCAGACCCCGAACTCGTGCTGTTAAGCCGAAATTACCAGGAACTAGAGC
GAATCCCACTCAGCCAAATGACCCGGGACGAGATCAATGCGCTGGTACAGGAGCTCGGCTTCTACCGCAAGTCGGCGCCG
GAAGCTCAGGTGCCCCCCGAGTACCTGTGGGCGCCCGCTAAGCCCCCCGAGGAAGCTTCAGAACACGACGACCTGTAGCC
CCGAGCCACAGTGGAGCTGGGACCCCCCCCTGCCAGCGCCCCGGAGACAGAATGGAGCGCTCAGT
Sequence Type mRNA
Unitrap ID UNI13996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3416845..3417230 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075702 (Selm) NM_053267 selenoprotein M Gene [Source:MGI (curated);Acc:Selm-001]

 
Come back to gene ENSMUSG00000075702


For any suggestions or comments, please send an email to unitrap@crg.es