Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14329A4
Clone ID IST14329A4
Vector VICTR74
Project tigm

Sequence tag IST14329A4BBF1
Sequence
GAGCAGTGTGTGCACGCGCAACTAGCTGCATCTATGGGCGCCTCTCCCACCCTTCTGCCTTCTGTCTCGCCTGTCAGGAG
GCCAGGCTGGGGCCTGAGAAGGCCCTGCAATGAGATCATGTTGTGAGGGGAGATGCTTTGTCAAGAATGCTACCAAAGAG
TTGGGCTGTGTGCGTGGTTGTGGCAGTGAGCAGGGTGGTGACGGTGAGCAGGCTCAGGCCTGGGGGCAGCACTGTATGGC
ACGAAAATGAGAGAGACAGAGACGGAATGCANAGCTGAGCACAGCCCAGACACTACAGCAAGCCGCCCAGGCANCCGCCT
CCACGTGGGGCCCTCTGATGCCNANCCCCCAACTCTTTGTTCTGCTGCNNCCTTTANCCTNTGCNCGCACGGGAGCANGA
GCACGCATGCGCACATGCNCNTGCNTCCNNAN
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26405096..26405523 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]


Sequence tag IST14329A4HMR1
Sequence
TGCTCAGCCNTTCCGTAACAGTCATACACCACCCCCAGAACCCACACACATCTGTGAACACCTATAGGTCTCTGTGCACT
GAAACCCCTCCACCATCACAGGACTCCTCAGGTACATGTGTTCATACTCAACAGTCAGACATACCAGGCATGAGCATACA
CGAGTATGCAAACAGACAGACAGACATGTGCATGTGCATGACATACAGCCNNNCTTACCTNNNNNNNNANNNTNNNNACA
CATACCCATACNNTCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26404891..26405100 208
NO GENE  

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es