Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_167D8-3
Clone ID CMHD-GT_167D8-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_167D8-3
Sequence
GCTGAGGCTCAAACTACTGGTGGGGCCCCGTGGAGGACCCTTGCATGTCTGAGCGTATCTGAGGACTGGAATGCCGTGTT
GTCTTCTGCCGGAATCAAAGTCACAAGGCCACCAGAGGAGCCCTCAGTACACGCCGGTCGGCACAGAAGGCTGCAGAGGT
GATTCCAGAGCGCCAATATGTGCTTGGTTTAGCCCTATTCTGTGGACAACGGAAACAACTGTCCATACGTCTCTGCCTTA
TTAAACAGTCTGTAGAACACACCCAACTCTAGTCACGGCATTCTGCTGAGGCATGGTGTAAC
Sequence Type mRNA
Unitrap ID UNI14000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99374815..99375114 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046242 (1600029I14Rik) thioredoxin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1917047]

 
Come back to gene ENSMUSG00000046242


For any suggestions or comments, please send an email to unitrap@crg.es