Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12945B5
Clone ID IST12945B5
Vector VICTR76
Project tigm

Sequence tag IST12945B5BBF1
Sequence
GTGAGATGGCTCAGTGGGTAANAGCACCCGACTGCTCTTCCNAAGGTCCAGANTTCAAATCCCANCAACCACATGGTGGC
TCACAACCATCCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI9754 UNI31200 UNI31201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61181375..61181479 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020085 (Aifm2) NM_001039194 apoptosis-inducing factor, mitochondrion-associated 2 Gene [Source:MGI Symbol;Acc:MGI:1918611]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32517581..32517685 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020272 (Stk10) NM_009288 serine/threonine kinase 10 Gene [Source:MGI (curated);Acc:Stk10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 56142882..56142986 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73376031..73376135 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42311748..42311852 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22419274..22419378 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 55888262..55888366 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 78574135..78574239 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 121025351..121025455 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 86425333..86425437 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866072..109866176 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 110576930..110577034 97
NO GENE  


Sequence tag IST12945B5HMF2
Sequence
GTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGC
TCACAACCATCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATA
AATAAATCTTAAAAAAATGCATAATAAATGAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136008590..136008783 178
NO GENE  

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es