Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14217E7
Clone ID IST14217E7
Vector VICTR74
Project tigm

Sequence tag IST14217E7HMR1
Sequence
ANGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACGCTTTANACNNGGCTAGTCTCAAAATCNNAAATTCACCTGA
CTCTACCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACTGCCCAGTTGTTTTTGTTTTTTTAAGATTTATTTATAA
TGGGTGTTTTGCTTTCAAGTATGTGTATGCACCATGTTTTACTTGNTGCCTACATANGTCANAAAGAAAGCATTANATTG
CCTGGAACTGGAAATGGCTGTAN
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17247205..17247464 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es