Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11711C7
Clone ID IST11711C7
Vector VICTR76
Project tigm

Sequence tag IST11711C7HMR1
Sequence
TGTGCCNCTGTGCTTATTACCTCTAAGAATTTTTAAAATTACATTTATCTATTTGTTTATGGCAGAGGATCACTTGTGCC
TCTGCACATGTGGCAGTCAGAGGACAGACAGCTTGAGGGTGTTCACTCCCAGGGGTCAAACTAAGGTGCTCAGGCTTGGC
AGCAAGTGCTTCTACCTGCCGAGTGAGCCNCCCCANNNNNNTCCACTGACTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140843269..140843490 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es