Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14227G1
Clone ID IST14227G1
Vector VICTR74
Project tigm

Sequence tag IST14227G1HMF2
Sequence
ATGTGAAACTCATTTGTAATCAAAGGAGGGTTTTTGGGTTTTTTGGTTTTTTTTTTTTTTGN
Sequence Type genomic DNA
Unitrap ID UNI10902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71196897..71196956 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]


Sequence tag IST14227G1BBF1
Sequence
ACCTGCTCACAGTGTCCGGACAAACCAAAGACTGAGTCATCACAGTTCTAGGATGACTCGCGGAACGCGAGTTCGAAGCC
CGGCGCTGCCACTCCCAACTTGATCTAGCGGCCACACTCCCTACCCCCGGCCACCTCTATATGACAAGGTGGGCGATCTG
GGAACCGGAGGAACACTAAAAGCAGCTTTCTAAACCAACCGAGCCCCAGCGGCTCTGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72655277..72655500 224
 
EST/CDNA Est Name
  BY003082.1 - AI464430.1

 
Come back to gene BY003082.1 - AI464430.1


For any suggestions or comments, please send an email to unitrap@crg.es