Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14103F12
Clone ID IST14103F12
Vector VICTR74
Project tigm

Sequence tag IST14103F12HMF1
Sequence
GGTGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGC
CATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI34022 UNI34023

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13280037..13280150 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36845437..36845550 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143552526..143552639 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 15079979..15080092 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 23462204..23462317 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017978 (Cadps2) NM_153163 Ca2+-dependent activator protein for secretion 2 Gene [Source:MGI (curated);Acc:Cadps2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 114998834..114998947 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27696704..27696817 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 66888338..66888451 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031189 (Aff2) NM_008032 AF4/FMR2 family, member 2 Gene [Source:MGI (curated);Acc:Aff2-001]

 
Come back to gene ENSMUSG00000031189


For any suggestions or comments, please send an email to unitrap@crg.es