Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12308B12
Clone ID IST12308B12
Vector VICTR76
Project tigm

Sequence tag IST12308B12HMF2
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCA
Sequence Type genomic DNA
Unitrap ID UNI20609 UNI31432 UNI33346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4750346..4750383 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4556470..4556507 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3054497..3054534 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3313861..3313898 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3046744..3046781 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8830886..8830923 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4059546..4059583 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3109269..3109306 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3140494..3140531 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3015191..3015228 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3342134..3342171 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024900 (Cpt1a) NM_013495 carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3343371..3343408 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3826488..3826525 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3782625..3782662 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3085714..3085751 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4589749..4589786 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015189 (Casd1) NM_145398 CAS1 domain containing 1 Gene [Source:MGI (curated);Acc:Casd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3282456..3282493 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4154845..4154882 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3349952..3349989 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 134925..134962 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 318190..318227 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 50567..50604 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 115393..115430 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 70792..70829 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 199162..199199 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166441: 234000..234037 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 15419..15456 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3158596..3158633 38
NO GENE  


Sequence tag IST12308B12BBF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAAACAAAACAAAACAAACAAACAAACAAAAAACAACAAAA
AAAGAATTGGAAAGTCTTGGGACTTGGAAGAAGTCTTGGACCTGATGATGCCTTTTGCTTTGCTTGGAGGTTGTAGGGTT
GGTANTGCAACTTGCCGGAAACAGATAAACCTGAAAGTCCTTTGAAACAATCAGGGTCTCTTCATAATGACTGAAAGACA
CTGAAGACTGGCAGATAGAGTTTTAGAATTTTCACTCATGGGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 31298006..31298293 286
NO GENE  

 
Come back to gene ENSMUSG00000025899


For any suggestions or comments, please send an email to unitrap@crg.es