Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12147G9
Clone ID IST12147G9
Vector VICTR76
Project tigm

Sequence tag IST12147G9BBF1
Sequence
GGTGTCGAGATAAAGAAATGCAGCTAAGACAGGCATTCTGATCAAAGCTCAATTTTACTGTTCCACACCCAATTATAAAG
CAGGGGAAGGGGACCCGATTCCCACCAATTAATCTTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20572611..20572732 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST12147G9HMF2
Sequence
GGTGTCNAGATAAAGAAATGCAGCTAAGACAGGCATTCTGATCAAAGCTCAATTTTACTGTTCCACACCCAATTATAAAG
CAGGGGAAGGGGACCCGATTCCCACCAATTAATCTTGGGATCCAATANCAGGGTGACCACGTGCACGGC
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20572611..20572759 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es