Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793D3
Clone ID IST14793D3
Vector VICTR76
Project tigm

Sequence tag IST14793D3HMF1
Sequence
CACCCACTAAATTTTTCTAGAATTCCACGTGTTGTTTCATCGTTCATATACTCTGCTACATGGCG
Sequence Type genomic DNA
Unitrap ID UNI16897

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 113155644..113155707 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049985 (Ankrd55) NM_029898 ankyrin repeat domain 55 Gene [Source:MGI Symbol;Acc:MGI:1924568]

 
Come back to gene ENSMUSG00000049985


For any suggestions or comments, please send an email to unitrap@crg.es