Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710F10
Clone ID IST14710F10
Vector VICTR76
Project tigm

Sequence tag IST14710F10HMR1
Sequence
GCGAATGTTGCNCGGTGGCATTGCCCGTTGGTTCCCCACAACCCTGACTTTACCCTAGATTCCACACTCCCGTTTTCTGT
GTCTCCTCCCTCCTCATCTCTCTGAGTCTCTATAGAAACCTCAGGCAGGTACCTTGTATTTTCCACTTGCATCGTCGCTT
TTCGTCCACAGATATCTGTCTCCCTATCACCTTCCTCTCTGGGCCGTCATGCAACGTTCTCTGCACTTTCTCTCTATTAC
TCTTTATGCCAGACATTCCCTCTCAAATTCCCAAGTTATATGCCCCATGTTGTCTCCCTGTGTGCGTGTGTGTTTGTTGT
GGCCCANTCTGTCATCTACTTCCTGCTGGTACCATCCCCACCCCTTCCCACCTGCTCNTCTCTTGACTTCTTTTAAGTTC
TTCCTTTTCTCTTTTCCNGCNACCCCCATCAGTCCCTTCTCAAGCTCCTAGAGACAACTGTGGACTTGGGGACCANNNAG
CACCCCCAGAGCACTAGAGGANCCCCTGCTGCCTGCCCTGCCTCANCCTGCCCCACAN
Sequence Type genomic DNA
Unitrap ID UNI24888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27950630..27951166 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058709 (Egln2) NM_053208 EGL nine homolog 2 (C. elegans) Gene [Source:MGI (curated);Acc:Egln2-001]

 
Come back to gene ENSMUSG00000058709


For any suggestions or comments, please send an email to unitrap@crg.es