Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10882G1
Clone ID IST10882G1
Vector VICTR76
Project tigm

Sequence tag IST10882G1BBF1
Sequence
ATCCCAGCATTCAAGAGGCTGAGGCAGGGGGATCTTCNTTAAAGTAAGGCCACCCCGGGCTACAGAAAGTTCTAGGCTAC
CTAAGGGCTACAGAGTCAGAGTCGTCATCCCTACCCCATGCCATGATGAGATATTCTCAGCTCTGCTTGTCCAATCCCCT
CACAGTCCTCGTGCCACAATGAGGTAAGATCAATTCCGCTCCGCTCGTCCAATCCCCGCACAGCACCCCCACCCAACCCC
GTGCCACANTGAGGTAANATCAATTCCGCTCCGCTCGTCCAATCCCCGCACAGCACCCTCACCCTACCCGTGCCACAATG
AGGTAAGATCAATTCCGCTCCGCTCATCCNATCCCCGCATAGCAGCCTCACCCCACCCGTGCCACAATGAGGTAAGATCT
G

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165686927..165687326 392
 
EST/CDNA Est Name
  DV066041.1 - CN678630.1 - CN670238.1 - BQ557916.1 - CN682831.1 - CD546981.1 - CD542561.1 - CB246134.1 - BB859998.1 - CD561836.1 - BY207768.1 - AA178103.1 - CJ121989.1 - BY201037.1 - CJ162878.1 - CJ177349.1 - BY070894.1 - BY070678.1 - CJ147149.1 - CJ147598


Sequence tag IST10882G1HMR1
Sequence
GATCNCAGGTGTGAGCCNCCACTCAGGATTTAGGTTTAGCATTCTGAATGGGTAATTAGAAGTCTGGAGCGCANANAGTA
NCTGCCTCTTTTTAGTTTGTTCTCTCATCAGGAGCCTCCTGTGCCTTGANAGGAGCACGCATTCANAGACCTCCATCTGG
GGAAGAGTGGGAAGGGTGGNCNGN
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165686751..165686929 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es