Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14674C5
Clone ID IST14674C5
Vector VICTR74
Project tigm

Sequence tag IST14674C5HMR1
Sequence
GTTNACACCTTAAATCCNAGCCCTCTGGATGCAGAACCGGGTGATTTCTGTGAGCTCAAGANCAACCTGGCCTACAGAGC
AAGTTCCNGGACAGTCAAGGCTACNCAGAGAAGCCCTGTCTCCAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312832..114312964 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST14674C5HMF1
Sequence
GAACTACTACCACACAGTCCTTTTATTAGACGAGGAAGTGCCTGGCCCTCCTCCTATGGGGGCCCAACTCTGAAATCCCT
TTTGCCAGCACCTACAACATGCCTTGCTTACTCATTGCTACTAGAGTAGTGAATATATTTGAGAAGCCACAATCCTGCTA
AAACCTAGTTGAAAACTGTAATGTAGTTCACCTCAACCTATCCTTCTACCTCCCAGGGCAGCTCCCAGGTCTCCTCAGAA
AGCCAAAAGTTCCATCAACAGCTTTTGCTTTGTCATGCCATCCCTGCTAATCCTGAATTTAAGGGATCCCCGANAAGCAA
AGATCTATTATGCAAGTGACTCCNGGAAGGTAGTTGGGATTCCAAGGCACTCAGCTAANGAAATGCNNAGGANTTGAAAC
ANAGANNTNNTCTCATGGAATTTGGTTCTGGCNNNNNAAACTCTTCCTCTCCCTCACTGNCNNTTTTNNNTCCCNNNCCN
TNNGTCGNATGCNNNAACNGTTTTCATAGNNGANANCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14674C5BBF1
Sequence
GAACTACTACCACACAGTCCTTTTATTAGACGAGGAAGTGCCTGGCCCTCCTCCTATGGGGGCCCAACTCTGAAATCCCT
TTTGCCAGCACCTACAACATGCCTTGCTTACTCATTGCTACTAGAGTAGTGAATATATTTGAGAAGCCACAATCCTGCTA
AAACCTAGTTGAAAACTGTAATGTAGTTCACCTCAACCTATCCTTCTACCTCCCAGGGCAGCTCCCAGGTCTCCTCANAA
AGCCAAAAGTTCCATCAACAGCTTTTGCTTTGTCATGCCATCCCTGCTAATCCTGAATTTAAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312961..114313268 306
 
EST/CDNA Est Name
  BP773478.1 - W83351.1 - BF722229.1 - BF011662.1 - AA002285.1 - AA123499.1 - AA222938.1 - AA140438.1 - AA667223.1 - AI316270.1 - AI594706.1

 
Come back to gene BP773478.1 - W83351.1 - BF722229.1 - BF011662.1 - AA002285.1 - AA123499.1 - AA222938.1 - AA140438.1 - AA667223.1 - AI316270.1 - AI594706.1


For any suggestions or comments, please send an email to unitrap@crg.es