Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14708E2
Clone ID IST14708E2
Vector VICTR76
Project tigm

Sequence tag IST14708E2HMR1
Sequence
GACNACAGTTGGCTAGCACGTGTGGGTTATTTGGAGCATGCTCAGATTAGAGCCCTAACTTTGCTCGAGGGAGGAGGATC
TGGCTGGGCCCAGCAGAGGATGGTGCTTGGAAGGCCTGAAGAAAGCTGCTCCGATAGCTCAGTTCACTCCCGGATTGTGT
CCTGTGGGTCTGATTATCTTTTGGGATTACTTGCACAGGGTANTGTTTACATACTTTGTTTTGTAACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI31250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130656590..130656820 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025340 (Rabgef1) NM_019983 RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rabgef1-001]


Sequence tag IST14708E2HMF1
Sequence
GTCCACTCTCAAGACTCTTCCAGANAAGCAGTCAGCACTCAAATGGACCATTACTAAGTACCAGAGCAGCAGATGTGGCT
CCACCTGAGCAGCAGCACGTCACACTGCATAAAGCATCTCCCCACAGGAGGGCTGTCTCCAGTGCTATCTGGCTCAGTTC
TGCTCCAGCCATTTCACCTTTCTCATACACTTCCGTGTCACAGCGTCTGAGAGTCTGAGCTTATCCAAGCCCTGGGCGAT
GCTAATGGGAACCACCCTGGAAAGCACTGCCAGTTGTGAAGCGACTCTTCTCTCCTGACCAGCAGGGGATGCCCTTTTCT
TTTTCAATTATTTTTATTTTTTCAATAGGAGTAATGCCTATGCATCACAGAAGCTAGAAAAAGACAGGCTTTCTGGANCT
AGANTTACAGGTACTTGTAAACNACCATGTGGATGCTGGGAATTNNANNNAAGTCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130656136..130656592 439
 
EST/CDNA Est Name
  AV131687.1

 
Come back to gene AV131687.1


For any suggestions or comments, please send an email to unitrap@crg.es