Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0046
Clone ID BC0046
Vector pGT2lxr
Project sanger

Sequence tag BC0046
Sequence
GCTCTTCTCCACAGTTACATTCTACTCCTGTCGGCCTAGCGTGCTGCTGGGAGTTGTCTGGAGGCCTGCGGCGCGGGGCT
GAGCGCCCTCGGACAGAGCAATCATGTCCCACAAACAAATCTACTATTCGGACAAATACGACGACGAGGAGTTCGAATAC
CG
Sequence Type mRNA
Unitrap ID UNI2224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89222077..89222200 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028044 (Cks1b) NM_016904 CDC28 protein kinase 1b Gene [Source:MGI (curated);Acc:Cks1b-001]

 
Come back to gene ENSMUSG00000028044


For any suggestions or comments, please send an email to unitrap@crg.es