Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14549B1
Clone ID IST14549B1
Vector VICTR74
Project tigm

Sequence tag IST14549B1BBF1
Sequence
TGTCTGAAGACAGCTACAGTGTACTCATATAAATAAAATAAATA
Sequence Type genomic DNA
Unitrap ID UNI5590 UNI20784 UNI34031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6936955..6936998 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14355002..14355045 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28130387..28130430 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11250579..11250622 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062203 (Gspt1) NM_146066 G1 to S phase transition 1 Gene [Source:MGI Symbol;Acc:MGI:1316728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59513679..59513722 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 43481643..43481686 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054021 (Sirt5) NM_178848 sirtuin 5 (silent mating type information regulation 2 homolog) 5 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915596]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 80389877..80389920 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11305691..11305734 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42675664..42675707 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48278235..48278278 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 52312265..52312308 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 37212875..37212918 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 149432906..149432949 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3620949..3620992 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9351565..9351608 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21653126..21653169 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 57401675..57401718 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 18367045..18367088 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 136559151..136559194 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027273 (Snap25) NM_011428 synaptosomal-associated protein 25 Gene [Source:MGI (curated);Acc:Snap25-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15913497..15913540 44
NO GENE  


Sequence tag IST14549B1HMR1
Sequence
NACACACCAGAAGAGGGAGTCAGATCTCATTACAGGTGGTTGTGAGCNACCATGTGGTTGCTGGGAATTGAACTCAGGAC
CTTCGGAAGAGCAGTCAGTGCTCTTACCCGCTGAGCCATCTCTCCAGCCCCACAGTGAACTTCTNNNTCC
Sequence Type genomic DNA
Unitrap ID UNI1201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 158627662..158627804 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027655 (Dhx35) NM_145742 DEAH (Asp-Glu-Ala-His) box polypeptide 35 Gene [Source:MGI (curated);Acc:Dhx35-001]

 
Come back to gene ENSMUSG00000027655


For any suggestions or comments, please send an email to unitrap@crg.es