Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10090F10
Clone ID IST10090F10
Vector VICTR75
Project tigm

Sequence tag IST10090F10BBR1
Sequence
ATATCACTAAATACAGTTAATTTTATCCCCTCCCAAATTCTTTATATTTTTTTTTCTGTAGATTTAGTTTATCCTGCAAA
CCTCTGAACAACTCTTATCACCTTTCCTGGGTATTACAATAGTACTGCCATTGTAACTGATAGTGCCACATTTCTTTTTC
TCTTCTTATCTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTGGGGGAAAAAGGTTAAACCCTTTTTGTTTTTTTTT
TT
Sequence Type genomic DNA
Unitrap ID UNI33489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 81691069..81691310 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es