Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10185B3
Clone ID IST10185B3
Vector VICTR76
Project tigm

Sequence tag IST10185B3HMF1
Sequence
ATACAACTTACTAAGTTCTATTAATTGTGTTGTAACTTCAGTCAGCGTTCCTCCCTCCGGGGCACCAGAACCACAGTGGC
AATAGAAACTACTGGCAAACGCCACGGGCGTCAGCAACTTCTGGGCTTATCCACCCTCACAGTCTGGATCCTACGCACGG
CCTATTATATATCCTATGCCCTTGCACTGCAGACCCCCAGTTTTCCAAGGGCATCTTCAAGAACCATCTCCAAAAGAAAT
TCTGAATGGCGTGAACTGAGTGCAAAGAAATAGCTGGTCTATGAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 140300894..140301178 285
 
EST/CDNA Est Name
  BY308709.1 - BY075919.1 - BY068773.1 - BY341818.1 - BY342180.1 - BY137620.1 - CJ175058.1 - BB861885.1 - BF120072.1 - BF159747.1 - CJ072912.1 - BQ922725.1 - BI153122.1 - BI656411.1 - BG173288.1 - BI411461.1 - BQ899903.1 - CJ161951.1


Sequence tag IST10185B3BBF1
Sequence
ATACAACTTACTAAGTTCTATTAATTGTGTTGTAACTTCAGTCAGCGTTCCTCCCTCCGGGGCACCAGAACCACAGTGGC
AATAGAAACTACTGGCAAACGCCACGGGCGTCAGCAACTTCTGGGCTTATCCACCCTCACAGTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI34036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 140300894..141031355 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053111 (Fank1) NM_025850 fibronectin type 3 and ankyrin repeat domains 1 Gene [Source:MGI (curated);Acc:Fank1-001]

 
Come back to gene ENSMUSG00000053111


For any suggestions or comments, please send an email to unitrap@crg.es