Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12613E12
Clone ID IST12613E12
Vector VICTR76
Project tigm

Sequence tag IST12613E12BBF1
Sequence
ATATAATGAAGTTCCATGTTAGCTTGGGCTATTATAGAATGAGAACTTGTCTTTAAAAGCACAAAAAATTTTTGGTTTCT
TCAGTAAACAGACTTCTTTTCCCAATTTATTTTTCATCTTTTTAATTTACAACTAAACTCTTTTTTTTAAAAATGGAAGC
CAGGTGGTANTGGCACATGTCTTTTTTTTAAAAAAAATTTATTTATTATTATACATAANTACACTGTANTTGTCTTCANA
CACATGANAANAGGGCATCAAATCTG
Sequence Type genomic DNA
Unitrap ID UNI30930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102948541..102948805 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]


Sequence tag IST12613E12HMF1
Sequence
ATATAATGAAGTTCCATGTTAGCTTGGGCTATTATAGAATGAGAACTTGTCTTTAAAAGCACAAAAAATTTTTGGTTTCT
TCAGTAAACAGACTTCTTTTCCCAATTTATTTTTCATCTTTTTAATTTACAACTAAACTCTTTTTTTTAAAAATGGAANC
CAGGTGGTAGTGGCACATGTCTTTTTTTTAAAAAANATTTATTTATNAN
Sequence Type genomic DNA
Unitrap ID UNI30930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102948541..102948746 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es