Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_162D11-3
Clone ID CMHD-GT_162D11-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_162D11-3
Sequence
CTGGTTACCACTTCCAGAACTGAACCCTTCTTGGAAACTGCTTGGCACAGTCTTCCCCACTTTTTGGCCTGGACGACACT
CTGTTGGTGATCCTGAGCTTGAGGCTGTAGTCTTTGAAGAGGCTTTTATAATGTGTTTTCCCTTCTGCCCAAATGTCACA
TGGAATCTTAATTGGCAGTTCACTCTAGAGTGGCTTCGGGGGCCCAAAAAGCTAGAAA
Sequence Type mRNA
Unitrap ID UNI14010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102140441..102140657 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034768 (Asb16) NM_148953 ankyrin repeat and SOCS box-containing 16 Gene [Source:MGI (curated);Acc:Asb16-001]

 
Come back to gene ENSMUSG00000034768


For any suggestions or comments, please send an email to unitrap@crg.es