Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_162D10-3
Clone ID CMHD-GT_162D10-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_162D10-3
Sequence
CACCTTGAAGTCAGGCTTCAGACAATCAAGAAAGAAGATGTAAACCATGGCCCTTGAAGAATCAAAGAAGAAAGGCAAAT
ATGTGCATTACTTCTACCCTTACTCTTTACTCTGAATAAATAGCTTTCTGCTTACCAGC
Sequence Type mRNA
Unitrap ID UNI14011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 18604431..18604569 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057195 (Ceacam13) NM_028171 carcinoembryonic antigen-related cell adhesion molecule 13 Gene [Source:MGI (curated);Acc:Ceacam13-001]

 
Come back to gene ENSMUSG00000057195


For any suggestions or comments, please send an email to unitrap@crg.es