Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15003D2
Clone ID IST15003D2
Vector VICTR78
Project tigm

Sequence tag IST15003D2BBF1
Sequence
GAGGGATGCTTTGGGCATTCTCCATGAATAATAACTTACCGAAAATATCTCCTTCCTAGAGGCAATAAGTGCATTAAGAT
GGGTAAAAACAAACCAAAAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93272263..93272371 109
NO GENE  


Sequence tag IST15003D2HMR1
Sequence
CCTCTTCCCCATTGACTGGTAAATGTGATGGGGGCTTTTTCCCTTCTTGATGGCTGTGTCGAGACAACCCTCTTCTGCCT
TTCCAGGTTAGCCTCCAGTCTCTACACAGAAGTGTTTTCAGCAGTGTAAGCGACAACCGTGCAGTTACAAGGGTACTCTG
ATAATCTGAAAGGAGGCATCCAGCAAGCTCTGAGTCGTCTACATCTCCTTTCTAAAGCAATGCATGAAGAGAAGTTAGGT
C
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93272368..93272607 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es