Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12263B7
Clone ID IST12263B7
Vector VICTR76
Project tigm

Sequence tag IST12263B7BBF1
Sequence
ATATGTAAAAAGCCTATCANGNNTATTTGTTTGTCCCCGTGAGAGCCAAGGCACAGCGGGACACCTGGTAGGANNCCNTG
GTCTCTTTCTACTCTGTGTGATTTGGGATTGGACTCAGGTCAATGGGCTCTGGGAGGACCCTTCACTCGCTGGTCATCTC
ACCAGCCCACAGTGCTTCCTTTATTGATATTTGTATTACTTTAATTATGTGCATGGGGGGAGTATGTGCACATGAATGTA
GTGTCCACAGAGGGGTCAGAGCCCCGGGAGCTGTGGGGTTTCAGGCAGTTATAGTTACCCGGTGTGGGTGCTGGGAATTG
CCCTTGGGTCCTCAGGAAGAGCAGTAAAGTATGAGCTCTTAACCNCTGAGCCATCTCTCCAGCCCACAGTGCTTCCTTTA
AATGAGATCAACCTGCTGGTCTGGTTATTACAGCCNATTTTCTGTGCCNGAAGGTTTCACATTTGAGTGGGTGGGTTCCG
ANACAGGGTCCACTGANTANCCCTGGTTGTCCTGGAAATCCNTCTGTANAN
Sequence Type genomic DNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74024245..74024772 502
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]


Sequence tag IST12263B7HMF1
Sequence
ATATGTAAAAAGCCTATCAGGTTTATTTGTTTGTCCCCGTGANAGCCAAGGCACANCGGGACACCTGGTANGAGTCCATG
GTCTCTTTCTACTCTGTGTGATTTGGGATTGGACTCAGGTCAATGGGCTCTGGGAGGACCCTTCACTCGCTGGTCATCTC
ACCAGCCCACAGTGCTTCCTTTATTGATATTTGTATTACTTTAATTATGTGCATGGGGGGAGTATGTGCACATGAATGTA
GTGTCCACAGAGGGGTCAGAGCCCCGGGAGCTGTGGGGTTTCAGGCAGTTATAGTTACCCGGTGTGGGTGCTGGGAATTG
CCCTTGGGTCCTCAGGAAGAGCAGTAAAGTATGAGCTCTTAACCNCTGAGCCATCTCTCCAGCCCACAGTGCTTCCTTTA
AATGAGATCAACCTGCTGGTCTGGTTATTACAGCCNATTTTCTGTGCCAGANGTTTCACATTTGAGTGGGTGGGTTCCGA
NNCAGGGTCCACTGAGTANCCCTGGTTGTCCTGGAAATCCNTCTGTANAN
Sequence Type genomic DNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74024245..74024772 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es