Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12616A1
Clone ID IST12616A1
Vector VICTR76
Project tigm

Sequence tag IST12616A1BBF1
Sequence
GGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCANCGCCTCTGTGC
TTCCGCCTGTTCCAGAAGCTGTCAGGTTCTCTNCCN
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI10320 UNI31253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 96626148..96626259 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27760859..27760970 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74120615..74120726 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38775320..38775431 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 16483321..16483432 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521475..35521586 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 42482029..42482140 110
 
EST/CDNA Est Name
  DT915661.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 47137560..47137671 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 19241020..19241131 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881929..10882040 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647891..20648002 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 94731380..94731491 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 17283680..17283791 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 58237751..58237862 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6742075..6742186 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11919848..11919959 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029629 (Phf14) NM_029404 PHD finger protein 14 Gene [Source:MGI (curated);Acc:Phf14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 67307767..67307878 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047370 (AC046145.16)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15652544..15652655 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 55485598..55485709 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 56719363..56719474 110
NO GENE  

 
Come back to gene ENSMUSG00000047370


For any suggestions or comments, please send an email to unitrap@crg.es