Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10199H12
Clone ID IST10199H12
Vector VICTR76
Project tigm

Sequence tag IST10199H12HMF2
Sequence
AACTCAGGTTGTACGGCTTAGCAGCAGATGTCTTTGCTCAGTAAGCCATCTATCTCATTGGCCTTGTGTTGCTGGAGCTG
TAAACTTGGATTAATCGAACCAGTACTTGAGAACTAAGTGACTTAAGTGGACAGCAGAGTCTCCCAACAGTTTCTGATAC
ATTGTTTATGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99321893..99322066 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST10199H12BBF1
Sequence
CTGAACTGCTCTAAAAATCCACAGGGACTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 122816044..122816077 34
NO GENE  

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es