Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10749E2
Clone ID IST10749E2
Vector VICTR76
Project tigm

Sequence tag IST10749E2HMF1
Sequence
GCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCT

Sequence Type genomic DNA
Unitrap ID UNI2895 UNI31810 UNI32719 UNI32720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27231370..27231406 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37554083..37554119 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28265184..28265220 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022523 (Fgf12) NM_183064 fibroblast growth factor 12 Gene [Source:MGI Symbol;Acc:MGI:109183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 26713897..26713933 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 40750553..40750589 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 41539389..41539425 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4598543..4598579 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20813641..20813677 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 18731408..18731444 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021779 (Thrb) NM_009380 thyroid hormone receptor beta Gene [Source:MGI (curated);Acc:Thrb-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36279860..36279896 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28382344..28382380 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51405592..51405628 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13522294..13522330 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 10406968..10407004 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40593300..40593336 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 58786080..58786116 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 45255617..45255653 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54753490..54753526 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052331 (Ankrd44) NM_001081433 ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]

 
Come back to gene ENSMUSG00000052331


For any suggestions or comments, please send an email to unitrap@crg.es