Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13053E3
Clone ID IST13053E3
Vector VICTR76
Project tigm

Sequence tag IST13053E3HMR1
Sequence
CAGTGATTGTGTTACCATTGTTTCTGAGCTAAGTTTGTGTGTGTGTGTGTGTGTGTGTGTTGTGTTGTGTGTGTGTGTGT
GTGTGTGTNTN
Sequence Type genomic DNA
Unitrap ID UNI2640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22895559..22895646 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]


Sequence tag IST13053E3HMF1
Sequence
CTTCAAAGCTAATACTTTTGCCCGCTGAACCATCTCCCTGGCCCGTCTTTCGAACCAATTCACCTCACCCTGAGCAACTT
TGTCCTGTCCAGTGATGGATAGACCTGTATAGAGAGAGGCGACAGTCATATCACAGAATAGCATGTCTTCAGTCTTCAAC
AGAAAGCCCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI14597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79724173..79724345 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009585 (Apobec3) NM_030255 apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:1933111]

 
Come back to gene ENSMUSG00000009585


For any suggestions or comments, please send an email to unitrap@crg.es