Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12442E12
Clone ID IST12442E12
Vector VICTR76
Project tigm

Sequence tag IST12442E12HMF1
Sequence
CTAGTACAATCACAGAAGCTTCATAATGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26654431..26654479 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es