Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10799B12
Clone ID IST10799B12
Vector VICTR76
Project tigm

Sequence tag IST10799B12BBF1
Sequence
ACATTTTAAAACTTAATATATTTTCTGTGGAGTGCTTANAACTTGGGGTGTTTTAGCATCATGTAAGTGTATTTTCCAGA
CCATATTATATTGTTAGTTTCTAATAAGCCCTTTGTACTTGTAATTAACCAAAAACCATGAAGTTGCCTTGGAACTGTTT
GTCATTTAAATAGCCTATTCATAATTCCNATTTCATGCTAAAGTTTAATGAACGAACACTTTTTGCTTAAAATCAATATT
GGGTGTACATGGAGAAAGGATTAGGGAAACATTTTTTTGGTAGCTTAAAAACTACTCAATATCTAGCTAATTAATCTGCT
AACATTGGTCTAATCTAATCTATATTTNATTTGTGTATTGGGAGGAANCTCTCATATTTCTCCNATTTAAATGACATCAC
ATTTGAAAANGTAAATTTGGAGAATCGAGCTNAGATTAGAGGAATCCTCAATCTAAACTGGGCACCACACTCTCAATGCT
GTTAACCTTTGGTGACNGGCTNNAACNTGGGTTCCTNCCTCNNTTN
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17984956..17985476 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST10799B12HMF1
Sequence
ACATTTTAAAACTTAATATATTTTCTGTGGAGTGCTTANAACTTGGGGTGTTTTAGCATCATGTAAGTGTATTTTCCAGA
CCATATTATATTGTTAGTTTCTAATAAGCCCTTTGTACTTGTAATTAACCAAAAACCATGAAGTTGCCTTGGAACTGTTT
GTCATTTAAATAGCCTATTCATAATTCCCATTTCATGCTAAAGTTTAATGAACGAACACTTTTTGCTTAAAATCAATATT
GGGTGTACATGGANAANGGNTTAGGGAAACATTTTTTTGGTANCTTAAAAACTACTCAATATCNANCTAATTAATCTGCT
ANCNTTGGTCTAATCTANTCNANNNNNNANNNNNNTATTGGGAGGAANCTCTCAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es