Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13920F4
Clone ID IST13920F4
Vector VICTR74
Project tigm

Sequence tag IST13920F4BBF1
Sequence
GGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACN
Sequence Type genomic DNA
Unitrap ID UNI21654 UNI31029 UNI31077 UNI32081 UNI32082 UNI33121 UNI34045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3699508..3699556 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3069588..3069636 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3760798..3760846 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3313802..3313850 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3585279..3585327 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8602892..8602940 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3736711..3736759 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4092517..4092565 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3192218..3192266 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10513110..10513158 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042942 (AK220484) NM_001083628 MKIAA4095 protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q5DTN6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3426859..3426907 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3383777..3383825 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9158352..9158400 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8524335..8524383 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047187 (Rab2a) NM_021518 RAB2A, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3315492..3315540 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6229410..6229458 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3428878..3428926 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078815 (Cacng6) NM_133183 calcium channel, voltage-dependent, gamma subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1859168]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3382763..3382811 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074497 (A430078G23Rik) NP_001028550 RIKEN cDNA A430078G23 gene Gene [Source:MGI Symbol;Acc:MGI:2442135]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8017088..8017136 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 128385..128433 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 607055..607103 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161895: 687890..687938 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161897: 215730..215778 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161898: 224765..224813 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 629027..629075 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 228559..228607 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161916: 260286..260334 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161919: 201045..201093 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161937: 854193..854241 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 327681..327729 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165798: 450985..451033 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 32113..32161 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 70733..70781 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 349691..349739 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166347: 548747..548795 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166367: 260944..260992 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166369: 282547..282595 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 246045..246093 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166371: 385437..385485 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166383: 110418..110466 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166390: 67886..67934 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166391: 4133..4181 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 99514..99562 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166408: 248551..248599 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166415: 80075..80123 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166417: 208210..208258 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166421: 94845..94893 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 51005..51053 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166437: 76129..76177 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 59883..59931 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6502154..6502202 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062393 (Dgkk) NP_808582 diacylglycerol kinase kappa Gene [Source:MGI Symbol;Acc:MGI:3580254]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 242117..242165 47
NO GENE  


Sequence tag IST13920F4HMF2
Sequence
GGGAGGCANAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATAC
AGAGAAACTCTGTCTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 27044470..27044566 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102288502..102288598 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148347545..148347641 95
NO GENE  

 
Come back to gene ENSMUSG00000062393


For any suggestions or comments, please send an email to unitrap@crg.es