Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10026B3
Clone ID IST10026B3
Vector VICTR75
Project tigm

Sequence tag IST10026B3HMF1
Sequence
TTATCTCTCCCTTCCTGGCCCTCCCGGAGTCCCCTGTGTTTTCTTACAACAGATATACCGAGTCCACCCCGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117034380..117034452 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10026B3BBF1
Sequence
ATGCTTGGTTACTGTTTCCATTTAAATTAAGAGGAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84860819..84860869 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST10026B3HMR1
Sequence
GGGGTTTAACGAAGGTGACATGTGAGACCNGCCTTGAACAGCAAGCTGCTTTTCAGCAGGTGAATATGGAAATAAGGGCA
AACTAGAAAGAAGAAATGACAAGCCCCGAGAACTGGGATGTGTGGAAAAAATGAAGGACAATTTAGGTGGGAATACAGTG
AGAGGGAGGGAGAGGGGGAGGGGAGAGAAAGGGGAAGAGGAGAAGGAGAGAAAGGAGGAGGAGAGGGAGAAGATACATGG
GAANAGAACAGTTATGTTANNAGAGAGGGGCNNACANNNATGTGGTCCACCCTCNANGGTGTCTCANANTTNNCNAGGCN
NAAGCTCTGCGTTCCCATGATNNTCNGGTCCCNANAGGATANGGGGCNNGCNNCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es