Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14341G2
Clone ID IST14341G2
Vector VICTR74
Project tigm

Sequence tag IST14341G2HMR1
Sequence
ATTATTAATTTCNAAGGCTAGGTAGGAATTGGTGGGCGGGGTGGAGATGAAACAGTGGACTTGGACTTGTAATTTGGTGT
CGTCCTCACTGGCATGTCCAGCGTGTTGAGAGTAGCCGTTGCAAGTGTTGGAGGGGACGGCNTGNCCN
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011933..98012079 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es