Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13914F10
Clone ID IST13914F10
Vector VICTR74
Project tigm

Sequence tag IST13914F10HMF1
Sequence
AATCCCAGCACTTGGGAGGCAGAGGCAGGCGGAT
Sequence Type genomic DNA
Unitrap ID UNI6918 UNI9057 UNI31432 UNI32547 UNI34055 UNI34056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3494058..3494091 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3143122..3143155 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015202 (Cnksr3) NM_172546 Cnksr family member 3 Gene [Source:MGI Symbol;Acc:MGI:2674130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3054425..3054458 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3257534..3257567 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020671 (Rab10) NM_016676 RAB10, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105066]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3624868..3624901 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8534932..8534965 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3215229..3215262 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3791029..3791062 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3089290..3089323 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3392117..3392150 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3390569..3390602 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3530263..3530296 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5276029..5276062 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3392272..3392305 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3627706..3627739 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005907 (Pex1) NM_027777 plasmacytoma expressed transcript 1 Gene [Source:MGI (curated);Acc:Pex1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3453772..3453805 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001376 (Ccdc132) NM_024260 coiled-coil domain containing 132 Gene [Source:MGI Symbol;Acc:MGI:1920538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3270081..3270114 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3400334..3400367 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3354664..3354697 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 23000..23033 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 57258..57291 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 131252..131285 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 304382..304415 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 120066..120099 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166283: 10472..10505 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166290: 2741..2774 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 163783..163816 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 3428..3461 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166327: 45205..45238 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166336: 24597..24630 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 20905..20938 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 19279..19312 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3569229..3569262 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 71147..71180 34
NO GENE  


Sequence tag IST13914F10BBF2
Sequence
AATCCCAGCACTTGGGAGGCAGAGACAGGCAAATTTCTGAGTTCGAGGACAGCCTGGTCTACAGAGTGAGTTCCAGGACA
GCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAAAAANCCGTANATTCNNTAATCTACCCTTTATTCCNATTATTCCTG
TATCTTCCTCTTTTCTTTTTCATCCCTTCTCCCTCCTTTATAAAAGTATATTTTATTCNCTTANNNTANTTGTCTCANAN
ACTACCNCTACCTGTTTGCCNANGCCTANAATCTTCTANCCTCCATGCANCCTTTTTTTCTTTTAAAGTTNATTTATANA
TNNGAGTACNCTANGGCTGTCTTCNGTCNCACCNNAANANGGCATGGGATTCCATTACNNANGATCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000079834


For any suggestions or comments, please send an email to unitrap@crg.es