Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12839B5
Clone ID IST12839B5
Vector VICTR76
Project tigm

Sequence tag IST12839B5HMF1
Sequence
ACTGGTTTCACTGGATAAATCCACTTTGAGGAGAATTTGCATTTTAGCCTTGTGACTGTTCGCCTGTACCTTGTCTAATG
TACAATCACTGTGGGATTTTTGCATCTCCATCTTTCCAGATTCGTGCAATCATTTTTTTTTNNNTTTNANTTTTN
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72659068..72659221 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]


Sequence tag IST12839B5HMR1
Sequence
CAGTACTCAATGAAAGAAAGATTTCTGACCNGGGACCNTAGCCNAAGGAAATCAGCGGGGTGGGGTGGAGTTTATCAGAA
ATCTTTTCNCCGTTNTGTTCTTTGGTAGGGGTGGANATTGNCCTANNTTTGNAANCNCCTCTNATCTGCCAACGTNATNN
ACNCNAACATCTCTCTGCTTGCGGCTCTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es