Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14957E1
Clone ID IST14957E1
Vector VICTR76
Project tigm

Sequence tag IST14957E1HMR1
Sequence
CAAATACNAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGAGCACTGAAACTCAGAGGAG
AGAATCTGTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACAATCTCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI14866 UNI31252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551219..4551368 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9747319..9747468 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8050139..8050288 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7809459..7809608 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110285..3110434 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3288450..3288599 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079407 (AC186757.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D9B9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3871295..3871444 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3385289..3385438 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17692356..17692505 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031849..3031998 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9829060..9829209 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6761843..6761992 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7083476..7083625 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8119256..8119405 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4601832..4601981 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4232671..4232820 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5812568..5812717 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6638349..6638498 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4183150..4183299 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48187..48336 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114658..114807 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134097..134246 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 10102549..10102698 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058254 (Tspan7) NM_019634 tetraspanin 7 Gene [Source:MGI (curated);Acc:Tspan7-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2531082..2531231 148
NO GENE  


Sequence tag IST14957E1HMF1
Sequence
TTTGGACCTCCTCCTGGCCGAAGAAGAAGGCCCAAAACAGGACCTTTCTCAGACAGTGTGTTGCTTTGGCAGTTCCCAGG
TGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTG
TGGCTTANGCCGCCTCCCCANCCGGGTGGGCACNTGTCCTTCGGTCCC
Sequence Type genomic DNA
Unitrap ID UNI36638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 124080723..124080929 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027200 (Sema6d) NM_172537 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D Gene [Source:MGI (curated);Acc:Sema6d-001]

 
Come back to gene ENSMUSG00000027200


For any suggestions or comments, please send an email to unitrap@crg.es