Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14424G4
Clone ID IST14424G4
Vector VICTR74
Project tigm

Sequence tag IST14424G4HMR1
Sequence
AAATGATTAAGTTCTTGTAAAGACTCTCAGAGTCAGTGCTGTATTGGTNATAAAAACGGCATATAATTACAGCTTAAGCC
TTGTTC
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298441..98298525 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]


Sequence tag IST14424G4BBF1
Sequence
ATTTAACCTTTACTATTGTCTTCATTCCTTTAGCACAATGTCACCTTAAGGCACCCAGCTTTTCCTCAACAAATGAGCAC
TGAGGTAATTCTTTTATTTAGGCTACCATAATACAACTGCAATGAACATGAGAATTCTGGTTCTTCTTTAAACTAATTTC
AAGTGCATGGAAACTATACTGAGAAGACTGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298522..98298719 198
NO GENE  


Sequence tag IST14424G4HMF1
Sequence
ATTNNNNNNNNACTANTGTCNTCATTCNNTTANCACAATGTCACCTTAAGGCACCCAGCTTTTCCNCAACAAATGAGCAC
TGAGGTAATTCTTTTATTTANGCTACCATAATACAACTGCNATGAACATGANAATTCTGGTTCTTCTTTAAACTAATTTC
AAGTGCATGGAAACTATACTGANAAGACTGCTGGGATCCATGGCAATTCTGTCATTTTTATGANAAGTCAGTANAATTGG
ATTGCTTGGGAGTAGGTATTATGTGCAAATGTATCANAATACATACATTAACTATGTAAAATTTTATNTNNACTATAACA
CAACATGGTCTTAACTAATTTTNATTGACATCTATGAAAAATCCCAACCTACTGCTTTCANAGTTNATTCCTAATACACN
ANCCTGTATCATATTCATATTNNNTATTCNATTCTGGACAATGCCTTATTTTCNNTCNTTTTGTNTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es