Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10124A10
Clone ID IST10124A10
Vector VICTR76
Project tigm

Sequence tag IST10124A10HMF1
Sequence
GGATATGAACATGTCCCANTGTCCCTCATCCTTTCCCGTTCCCTCCTCCCCCAAGGATGGGTCACAGTTTCCAAGCTAAT
GACAATACCAGGACACAGTGGCCCGGGTAGGGTGGCATAGTACAAGTCGTTACAGAAGGTTCCAGATAAGAGTCACTTTG
CCAGGAGGCAGCTCAGCTGGAATACAGCCAGCCCGCANCCTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122852956..122853159 200
NO GENE  


Sequence tag IST10124A10BBR1
Sequence
TAGGGAGGCAAGGCCACAGAGTTCTGAGTGTTCCCACAAGGTTCATGAACGTTTGTTGGGTGGTAACTCCATTTTTTTTT
TTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI33211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138537157..138537241 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040167 (Ikzf5) NM_175115 IKAROS family zinc finger 5 Gene [Source:MGI (curated);Acc:Ikzf5-001]


Sequence tag IST10124A10BBF2
Sequence
GGATATGAACATGTCCCAGTGTCCCTCATCCTTTCCCGTTCCCTCCTCCCCCAAGGATGGGTCACAGTTTCCAAGCTAAT
GACAATACCAGGACACAGTGGCCCGGGTAGGGTGGCATAGTACAAGTCGTTACAGAAGGTTCCAGATAAGAGTCACTTTG
CCAGGAGGCAGCTCAGCTGGAATACAGCCAGCCCGCAGCCTTGGCCAATGTGCGACCTGGCAACTGGGTCCCTGGCCCTC
ATCCTTCTCTGCAGCATTGGGAAGGGCGGGTGACCAAAACAACATACTGTATTGAAGACCCCTGCACACTCCCATGCTAC
GGATGAGTAAGCTGAGGCTCTGCCCAGAGCCTGGGGTTTCTGGAGGCCTCTGATGCCATGTGACCCTCTGCCTCACTCTT
TCTGGCAGCCCCAGGTCTGTGGGGGCTGTCAGGCTTGCACTTCTTACCTACCCCTCCCTGGCACCCCGTTACAACATCCA
ACAGCATTTATGTAGCACTGAGCTGAGACGTTGCTATAGCACACTGGGTAATGGTGCTGGTAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122852956..122853499 524
 
EST/CDNA Est Name
  CJ052809.1

 
Come back to gene CJ052809.1


For any suggestions or comments, please send an email to unitrap@crg.es