Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0660
Clone ID GC0660
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0660
Sequence
CGGGGTATCCTGGAGTGTGGCCATAGTAACCTCCGCTCCCCAATGCAGTTGCACTTTGACCTGGTAAATCCTCTGCAATC
ACAAACTCATCCTTTATAGAAGAGAACTCCACCTCTGTCTGATTACTAGCATTCATGGA
Sequence Type mRNA
Unitrap ID UNI222

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55020576..55021182 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es