Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14879E5
Clone ID IST14879E5
Vector VICTR76
Project tigm

Sequence tag IST14879E5HMR1
Sequence
AACCNAGTGGATTTNNTTTTCATTAAGTTAAAATTCTTTTTTCTGAAATGTATTGCTTGGATAGGGAGCTATGTGAGTGC
GTAAGCAAGATAGTTTTGGCCNGC
Sequence Type genomic DNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3155451..3155551 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]


Sequence tag IST14879E5HMF1
Sequence
GGTTAAAAAGAAAATATGCCCACTGTTACATATTAAATAATGATTTACTGACCTTATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3155395..3155454 60
NO GENE  


Sequence tag IST14879E5BBF1
Sequence
GGTTAAAAANAANANATGCCCACTGTTACATATTAAATAATGATTTACTGACCTTATGTTAACATTTAAATAATCTCACA
CAATGGATTTTTCAGAAAGAATTAACTTAAAAGTTAGGATTTGCAAGTTGCTAATGAGACAAGTTAGCACTGAATAATAA
GCAAAAGTTATCAATGTGGTTTTTAAGGAGTATTTTCCTTTGACTTACAGCAAACTCTGATGACAAATTCCCAATGCATC
AGTGTCCACCCCAAACAGCTGCCTCCACGGAGCACTGAAGACTGAGGCTTCACAAGCGCAGCAGCCCTTAAGCCAAGCAN
CACAGCACCCTGACNAATTCTTCCTCCNCCACCAAAGGCNACATTAACACACTGCANGCAGTTTCTCACACNACATTATG
CCANCTTANCACACNTANAANAGCNAAANATTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3155022..3155454 401
 
EST/CDNA Est Name
  CV304002.1

 
Come back to gene CV304002.1


For any suggestions or comments, please send an email to unitrap@crg.es