Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14780H4
Clone ID IST14780H4
Vector VICTR76
Project tigm

Sequence tag IST14780H4HMR1
Sequence
AGTATAGAGATTTTCNAGAGGACACAAACATTAAGGAAGTTAGAGTTCCAGAAAGGAAATTTACAGCTCAAAACTGGAGT
TAGACCATGAGGGGCTTTTTAAACTTTGTTAATTCTTCTAAACATTAAGTTAGGAAGATGGCTATATTCATCTTTTACCT
CACTGAACTATAGTGGAAATATTAGACAAGTTATTTATCACCANTGTCC
Sequence Type genomic DNA
Unitrap ID UNI15132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77382078..77382285 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]


Sequence tag IST14780H4HMF1
Sequence
NNNTANTAACTCATTAGCNNNGTANATTTANCCNANNAACCNNTGGGCTGCTAANTACTAAAGAGCANCANACACAANAT
ACTGATTTAATATGGGAGACACGAGTTTTAGTCAATACTTGATCCAAATTCNNTTCACANCAGTTACACTGGGTGGCTCA
TGTGTACTCCTGCTTCAAGACAGGCCCTGGCTTCTGTGCATCTGTACTCAAGTGCACACAACCACGGATACAAAACCAAC
AAAGTAAAATAGAAGCCAGAGAGATTGCTCAGCANTTAAGAACACTCCGATGTTTTACAGTGCACCCAGGTCCAGTTCCC
AGAATCTATAGGGTAGTTTACAGCCNTTCAAAATTAAACTATAGATATGAACACCTTCTTCGGANCCTTGTCAGCNCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es