Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12615B6
Clone ID IST12615B6
Vector VICTR76
Project tigm

Sequence tag IST12615B6HMF1
Sequence
CTGGCTATTATAAATAAGGCTGCTATGAACATANTGGAGCATGTGTCCTTCTTACCTGTTGGGGCATCTTCTGGATATAT
GCCCAGGAGAGGTATTGCTGGATCCTCCGGTAGTACTATGTCCNGTTTTCTGANGAACCGCCNGACTGATTTCCNGAGTG
GTTGTACAAGCCTGCACTCCCACCNACAATGGAGGAGTGTTCCTCTTTCTCCACATCCTCNCCAGCATCTGCTGTCACCT
GANTTTTTGATCTNANCNNTTCTGACTGGTGTGAGGTGGAATCTCANGGTTGTTTTNATTTGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12615B6BBF1
Sequence
TTGGCTATTATAAATAAGGCTGCTATGAACATANTGGAGCATGTGTCCTTCTTACCTGTTGGGGCNTCTTCTGGATATAT
GCCCAGGANAGGTATTGCTGGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10434 UNI34066 UNI34067

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37771009..37771112 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13975921..13976024 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 70368534..70368637 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022707 (Gbe1) NP_083079 glucan (1,4-alpha-), branching enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1921435]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41834699..41834802 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 50790696..50790799 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 59012622..59012725 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40612135..40612238 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5786542..5786645 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19615031..19615134 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6158334..6158437 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5221522..5221625 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53287810..53287913 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 60255381..60255484 98
 
EST/CDNA Est Name
  AW112547.1 - AW110233.1 - AW112655.1 - CA456470.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41141672..41141775 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 47537797..47537900 98
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 43485489..43485592 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026866 (Kynu) NM_027552 kynureninase (L-kynurenine hydrolase) Gene [Source:MGI (curated);Acc:Kynu-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 65518043..65518146 98
NO GENE  

 
Come back to gene ENSMUSG00000026866


For any suggestions or comments, please send an email to unitrap@crg.es