Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13966E7
Clone ID IST13966E7
Vector VICTR74
Project tigm

Sequence tag IST13966E7HMF1
Sequence
CAACCACCCGTAATGAGATCTGATGTCCTCTTCTGGTGTGTCTGAANACAGCTACAGTGTACTTACATATAATAAATAAA
TAAATCTTTAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30988 UNI33166

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261728..14261825 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30348658..30348755 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8689953..8690050 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77516354..77516451 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51091204..51091301 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020385 (Clk4) NM_007714 CDC like kinase 4 Gene [Source:MGI (curated);Acc:Clk4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107693647..107693744 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12362535..12362632 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73151511..73151608 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86872218..86872315 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121381266..121381363 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 114583988..114584085 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101167271..101167368 94
NO GENE  

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es