Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13719D10
Clone ID IST13719D10
Vector VICTR74
Project tigm

Sequence tag IST13719D10HMF1
Sequence
CCTCCATACTGTTTGGANAGTGCCATTTCTATACTGCGAAGCTTATCATGTCTCACCCCTTCCATGACAATCTTTATGGC
TCCTTTTAAAATCTANATTCCTTAGTACAGAGTTCAAGGCCTTCCTGATCTGTCACACACCTCAATTCCAGCTGCCCCCA
AANAACTTCCTGGGAAGGCACCTTCATGTTTACNAATATGCCTTANACACAGACCCATCTAAGGCCCAGTGATGTAAGTG
GCCNNCC
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117035417..117035659 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST13719D10BBF1
Sequence
CCTCCATACTGTTTGGAGAGTGCCATTTCTATACTGCGAAGCTTATCATGTCTCACCCCTTCCATGACAATCTTTATGGC
TCCTTTTAAAATCTANATTCCTTAGTACAGAGTTCAAGGCCTTCCTGATCTGTCACACACCTCAATTCCAGCTGCCCCCA
AAGAACTTCCTGGGAAGGCACCTTCATGTTTACCAATATGCCTTAGACACAGACCCATCTAAGGCCCANTGATGTAAGTG
GCCNTCTTTCTTACAGCCTCCCTTCACGCTGCCATTGCTTCCTTGGTGCCTCCACCCAGGATCTATGTCAGCGGCCACAC
CATTTTCTAATTGTCTTTGTTTTTCNCTGCCNCTANGTNATGGGCTTCTTCNAAAAANGTCCTGTGTTTCTTTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117035261..117035659 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es