Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11010E2
Clone ID IST11010E2
Vector VICTR76
Project tigm

Sequence tag IST11010E2BBF1
Sequence
AAAGAAGGAATTGATAACATCAAGTATATATAATATTTTAAATTTATATTTTTATTTATTTTCTGTGAGTGTGTTTGAAG
GCCAGAAGACAATTTTAGGGAGTCGGTTCTCTCTTCACTGTGTGGTTCTAAAGGTCAAACACAAGCTTGTCANCTTGGAG
TCCGTGCGCTTTATCTTTTGATCCATCGAAGAGGTTACAGATGTGGCCTTTTCCCCANNNTTCCTTACTTTTATGTGTAT
GGGTGTTTTGTCTATATGTATATATGTGTACCACATGCATGTANTGACCANTGGAGGCCAGAAGAAGGCATCCATCCGAT
CCTGTGGGACTAGAGNNACAGAGGGTATGANCTACTGTGTTGGTGATAAGAATCAAATCTGGGTCCTNTGTAANAGTAAA
CNCNTGTN

Sequence Type genomic DNA
Unitrap ID UNI25831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95589114..95589520 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075595 (Zfp652) NM_201609 zinc finger protein 652 Gene [Source:MGI (curated);Acc:Zfp652-001]

 
Come back to gene ENSMUSG00000075595


For any suggestions or comments, please send an email to unitrap@crg.es