Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_152H4-3
Clone ID CMHD-GT_152H4-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_152H4-3
Sequence
CTTTAGCAAACAATCAACAATCCAGTAAGTTGCTGTATGATTGGAGGCATATGCAGGTATCTGTGCAAGGGCAACATTCT
TCAGAATGGCAATTGTGGAGTTACTAGTCTCAACTGCTGCAAGAGAAAATAGAGAAGAAGTCAAAGATCCAGTGAACCAA
AGAAAACAATTTGCACCTCCATGAAGATGAACAAAACATAAACTAAATTAAAGTTCCTTGATTAAATGCAAACGCATGTT
GGCC
Sequence Type mRNA
Unitrap ID UNI13945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 19250696..19250938 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039785 (Defb5) NM_030734 defensin beta 5 Gene [Source:MGI (curated);Acc:Defb5-001]

 
Come back to gene ENSMUSG00000039785


For any suggestions or comments, please send an email to unitrap@crg.es