Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12709E6
Clone ID IST12709E6
Vector VICTR76
Project tigm

Sequence tag IST12709E6BBF2
Sequence
ATAGAACAAATTTTNNCTTNATATCATTTANGTCNNTGCTTCCTAGTTCCTGNCAGTGTAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12709E6HMF1
Sequence
ATAGAACAAATTTTTACTTCATATCATTTAGGTCATTGCTTCCTAGTTCTTGACAGTGTAAATGTATCTACCCTTTAAAA
AACTAANCCTATTTGATTTGGTTTATATTATGGAAGAGACTATGTNNACAAGTGTGNCCA
Sequence Type genomic DNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176863849..176863987 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es