Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_152E12-3
Clone ID CMHD-GT_152E12-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_152E12-3
Sequence
AGTAACTGAGAGGGGACATACAAAGATGCTCTGAGGACCATCAGGTCCAAACTCATGGAAGTGATAACATTTAACAGTGC
AATGAACAATTTCTTTATTTATGTACTATTAAAAAAAAACTGTAAATGCAATGTAAAGACACACAGCCACACATATTCCA
CAGTTATTTTCTTGTGTTCTTCTCTTACTTACACCACCCACCTTAACTCTTTCTTGTCAGGAGTATAT
Sequence Type mRNA
Unitrap ID UNI14030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 73895848..73896075 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052516 (Robo2) NP_780758 roundabout homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Robo2-004]

 
Come back to gene ENSMUSG00000052516


For any suggestions or comments, please send an email to unitrap@crg.es